|
Vazyme Biotech Co
qpcr taq pro universal sybr qpcr master mix vazyme biotech co Qpcr Taq Pro Universal Sybr Qpcr Master Mix Vazyme Biotech Co, supplied by Vazyme Biotech Co, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/biotech+co/Taq+Pro+Universal+SYBR+qPCR+Master+Mix/pm41886117-62-11-19 Average 99 stars, based on 1 article reviews
qpcr taq pro universal sybr qpcr master mix vazyme biotech co - by Bioz Stars,
2026-09
99/100 stars
|
Buy from Supplier |
|
Sangon Biotech
sangon biotech co Sangon Biotech Co, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/biotech+co/biotech+co+sangon/pm42280095-166-7-7 Average 86 stars, based on 1 article reviews
sangon biotech co - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Jiangsu Cowin Biotech
cw2020m 2× superfast universal sybr master mix jiangsu cowin biotech co Cw2020m 2× Superfast Universal Sybr Master Mix Jiangsu Cowin Biotech Co, supplied by Jiangsu Cowin Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/biotech+co/2%C3%97+biotech+co+cowin+cw2020m+jiangsu+master+mix+superfast+sybr+universal/10__1016_slash_j__isci__2026__115796-113-73-80 Average 86 stars, based on 1 article reviews
cw2020m 2× superfast universal sybr master mix jiangsu cowin biotech co - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Jiangsu Cowin Biotech
assays ultrapure rna kit jiangsu cowin biotech co Assays Ultrapure Rna Kit Jiangsu Cowin Biotech Co, supplied by Jiangsu Cowin Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/biotech+co/kit+rna+ultrapure/10__1016_slash_j__isci__2026__115796-113-51-55 Average 86 stars, based on 1 article reviews
assays ultrapure rna kit jiangsu cowin biotech co - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Jiangsu Cowin Biotech
cw0581m hifiscript gdna removal rt mastermix jiangsu cowin biotech co Cw0581m Hifiscript Gdna Removal Rt Mastermix Jiangsu Cowin Biotech Co, supplied by Jiangsu Cowin Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/biotech+co/biotech+co+cowin+cw0581m+gdna+hifiscript+jiangsu+mastermix+removal+rt/10__1016_slash_j__isci__2026__115796-113-61-67 Average 86 stars, based on 1 article reviews
cw0581m hifiscript gdna removal rt mastermix jiangsu cowin biotech co - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Sichuan Kelun
sichuan kelun biotech biopharmaceutical co Sichuan Kelun Biotech Biopharmaceutical Co, supplied by Sichuan Kelun, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/biotech+co/biopharmaceutical+biotech+co+kelun+sichuan/pmc13150324-239-12-12 Average 86 stars, based on 1 article reviews
sichuan kelun biotech biopharmaceutical co - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Sangon Biotech
shanghai sangon biotech co Shanghai Sangon Biotech Co, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/biotech+co/biological+co+engineering+sangon+services+shanghai+technology/pm42042332-90-17-18 Average 86 stars, based on 1 article reviews
shanghai sangon biotech co - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Jiangsu Cowin Biotech
jiangsu cowin biotech co Jiangsu Cowin Biotech Co, supplied by Jiangsu Cowin Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/biotech+co/biotech+co+cowin+jiangsu/pmc12919249-142-3-3 Average 86 stars, based on 1 article reviews
jiangsu cowin biotech co - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |
|
Sangon Biotech
tttgcactggtacgtgttgat sangon biotech co Tttgcactggtacgtgttgat Sangon Biotech Co, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/biotech+co/biotech+co+sangon+tttgcactggtacgtgttgat/pm41895270-251-186-187 Average 86 stars, based on 1 article reviews
tttgcactggtacgtgttgat sangon biotech co - by Bioz Stars,
2026-09
86/100 stars
|
Buy from Supplier |